Python is a total beginner

I'm studying Python without knowing it completely, and I'm going to ask you a question about the function setting def

 my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGC"        

    def get_at_content(dna):

     length = len(dna)

     a_count = dna.count('A')

     t_count = dna.count('T')

    at_content = (a_count + t_count) / length

    return at_content

How can we wrap this up here to move on Should I just type in and continue?

python

2022-09-22 18:50

1 Answers

To learn Python, why don't you go to The Ugly Coding Baby or Introduction to Python

2022-09-22 18:50

If you have any answers or tips

Popular Tags

python x 4647

android x 1593

java x 1494

javascript x 1427

c x 927

c++ x 878

ruby-on-rails x 696

php x 692

python3 x 685

html x 656